Entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae act as growth stimulators of maize (Zea mays).

Fungal strains and conidia suspension

EPF strains B. bassiana Bb-13 and M. anisopliae Ma-73 was used in the study. These fungi are stored in the RCEF strain bank of Anhui Agricultural University, Provincial Microbial Control Laboratory.

Suspension of conidia B. bassiana and M. anisopliae strain was inoculated into PDA and SDAY medium, respectively. After 14–18 days of cultivation, conidia were collected by scraping the conidia from the surface of the agar with a sterile inoculating shovel, and a certain amount of conidia was placed in sterilized 0.05% Tween-80 (v/v) and mixed well. suspensions of fungal conidia38,39. Conidial concentrations were determined using a hemacytometer and the final suspension was adjusted to 1 × 10.7 conidia ml-1.

Plants

corn (Z. Mays, Jingnuo No.1) seeds were purchased from Shouguang Yino Agricultural Science and Technology Co., LTD. Maize (100 seeds per treatment) were planted in breeding discs with 32 holes (5.4 × 6 × 5 cm) each, containing sterilized culture substrates (Klasmann peat, German) (approximately 30 g of sterile soil was placed in each hole). ). A seed was placed in each hole. All maize seedlings were grown under greenhouse conditions with automatically controlled environmental factors (25 ± 1 °C, 70 ± 5% RH and 16L: 8D regime) for 14 days.

Fungal inoculation of corn seedlings

90 straight and well-developed maize seedlings were randomly sampled for each treatment. Culture substrates on the roots of each maize seedling were gently washed with distilled water without damaging the roots. Treated maize seedlings with equal development status, including above-ground and underground parts, were transplanted into the maize hydroponic cultivation system.

The corn hydroponic cultivation system is constructed with an opaque plastic box (Specifications of the working box: length × width × height = 67 × 42 × 17.5 cm3) was covered with a 40-hole opaque plastic plate to which 45L 1/2 Hoagland nutrient solution (1/2) was added as hydroponic nutrient solution. The maize seedling was carefully transferred to the cultivation pit by securing the plant stem with a sponge block.40. The oxygen supply for the maize hydroponic cultivation system was provided by a small ventilation pump (Risheng Group Co. LTD., CHN).

1×10 to 100 ml conidia suspension for maize seedlings after two days of taming.7 conidia ml-1 added to each hydroponic solution. Eighty plants were used as a control, to which 100 ml of sterile 0.05% Tween-80 (v/v) was added.

Measurement of plant growth

Maize seedlings were randomly sampled weekly for each fungal treatment and control. All plant growth indices including plant height, root length, leaf length, leaf width, number of leaves and fresh weight (above ground, below ground and total) were carefully measured.20. Above-ground and below-ground parts were weighed separately on an analytical balance (Yue Ping Scientific Instrument Co., LTD., CHN). All measurements were made by two separate batches of eight randomly selected maize seedlings.

Fungal population dynamics in hydroponic solution

Population density B. bassiana and M. anisopliae monitored periodically up to day 7 in hydroponic solution. One milliliter of hydroponic solution was randomly sampled 5 times from a depth of 2 cm with a micropipette. Sampled hydroponic solutions were diluted in a 10, 100, 1000, 10,000-fold dilution gradient with 0.05% Tween 80. After that, 100 uL of hydroponic solution at 5 concentrations was sampled and spread evenly in a petri dish for fungal growth. Five repetitions of BSM (Boveria selective medium, quarter-strength PDA containing 350 mgL-1 streptomycin sulfate, 50 mgL-1 of tetracycline hydrochloride and 125 mgL-1 cycloheximide) petri dishes were used to estimate the fungal population in terms of CFU. Petri dishes were incubated at (25 ± 1) °C for fungal growth. Fungal colonies in Petri dishes were counted and identified. The optimal diluted concentration of the sampled hydroponic solution is a CFU count between 10 and 100 CFU/plate.41. CFUs in the optimal range were used to assess population dynamics in hydroponic solutions.

Determination of fungal colonization in maize tissues

Recovery of entomopathogenic fungi from maize tissues

The fungus was re-isolated and inoculated with cultured tissues of roots, stems and leaves of corn seedlings. B. bassiana or Like M. anisopliae rhizospheric fungus in a fungal selective medium to confirm fungal endophyticity. First, the tissues of the roots, stems and leaves are cut into pieces 0.5 cm long (root and stem) or 0.5 cm long.2(leaves) and small tissue pieces were sterilized with 1% sodium hypochlorite for 5 min, then soaked in 75% ethanol for 1 min.42. Washed three times in sterilized distilled water, tissue samples were inoculated in BSM medium and incubated in the dark at (25 ± 1) °C. The effectiveness of the plant tissue sterilization procedures was evaluated by inoculating 100 µl of the final rinse water on PDA medium to check for bacterial or fungal growth.

BSM petri dishes were checked daily for fungal colony formation. Each fungal colony grown on BSM medium was inoculated onto PDA or SDAY medium to identify the fungal species. Only tissues with a typical fungal colony B. bassiana or M. anisopliae growth represented successful fungal endogenesis in plants. Mushroom recovery rates B. bassiana or M. anisopliae in different tissues was calculated as follows: Fungal recovery rate =[number of tissue pieces with B. bassiana or M. anisopliae colony/the total number of tissue pieces]× 10043.

DNA extraction of maize tissues

For DNA extraction, whole maize tissues (100 mg) were sampled and sterilized as above procedure and then cut into small pieces with sterilized surgical scissors. Each tissue sample was transferred to a 1.5 ml centrifuge tube with steel balls attached39. The tube was placed in frozen liquid nitrogen for 2 minutes, and then the tissue sample was quickly ground in an automatic grinding machine (Jingxin Technology Co., LTD, Shanghai) for 150 seconds. DNA was extracted from the sample tissue by following the steps of the fungal genomic DNA extraction kit (Vokai Biotechnology Co., LTD., Beijing). The quality of the extracted DNA was checked with a micronucleic acid protein detector (Wuzhou Oriental Technology Development Co., LTD., Beijing). The extracted DNA samples were stored at -20 °C for PCR amplification.

PCR detection

All extracted DNA samples were evaluated by PCR amplification with specific primers B. bassiana (F5′-TTCCGAACCCGGTTAAGAGAC-3′, R5′-TTCCGAACCCATCATCCTGC-3′)44 or M. anisopliae (5’GACTCTCTTAAGGTAGCCAAATGCC3′, 5’AAACTCCCCACCTGACAATG-3′)45. 1.5 uL gDNA, 10 uL 2 × Tap master mix, 0.4 uL (10 uM) primer 1, 2 were added to the PCR performed by PCR Phire kit (Vazyme, Nanjing) and PCR reaction system (20 µL) respectively. and includes ddH.2O 20 uL was added. PCR amplification protocol for B. bassiana started at 95 °C for 3 min, followed by 35 cycles of 95 °C for 15 s, 55 °C for 15 s, 72 °C for 25 s, followed by 72 °C for 5 min extension and M. anisopliae This was followed by 40 cycles of 15 s at 95 °C, 15 s at 65 °C, and 15 s at 72 °C. PCR products were stored at 4 °C and detected by electrophoresis on 1% (w/v) agarose gels in TBE with ethidium bromide and visualized under UV (302 nm) light (BioRad, USA).

Statistical analysis

All experimental data were analyzed using IBM SPSS Statistic (Version 20.0) for univariate ANOVA analysis, and Turkey HSD was used to test the significance of differences between treatments (P ≤ 0.05).

Permit for collection and use of plant material

A permit is not required as the plant material is obtained from a certified dealer in the local area. The use of plants or plant materials in this study is in accordance with international, national and/or institutional guidelines.

Ethical approval and consent to participate

The study was conducted without violating any ethical guidelines.

Leave a Comment